Note CC

carnet de recherche-action, ateliers et notes libres

Outils pour utilisateurs

Outils du site


Notes sur les analyses DIY sur OGM

Suite à participation comme intervenant à Fab 14, et rencontre avec avec Guy Aidelberg qui travail sur GMO detetctive

Principe de base

Avec un protocole d'extraction d'ADN de 5 minutes qui ne nécessite que de l'eau. Ceci est couplé à de nouvelles techniques d'amplification de l'ADN isotherme, détectées par fluorescence, en utilisant des LEDs et des filtres en gel plastique ultra abordables. Le premier cas d'utilisation est la détection d'OGM dans les aliments. L'expérience rapide permet à n'importe qui de voir avec les yeux si un gène est présent. Que ce soit dans une école, un biohackerspace ou une cuisine, nous vous encourageons à télécharger, partager et discuter vos résultats avec d'autres personnes à travers le monde. Autonomiser et (de s'auto éduquer les citoyens, tout en permettant la collecte et le partage de nouvelles informations.)

Voir également : Notes de recherche-action sur biononymous & bioprivacy


La manipulations est tehcniquement simple à réaliser et nécessite peu de matériel, peu encombrant.

Le défi principal est le wetware, c'est à dire le matériel biochimique utlisé lors de l'expérimentation.

Compter pour 250 réactions, soit 30 expériences (une réaction LAMP régulière est de 25ul, nous faisons 8x10ul réactions par expérience).

L'amplification isotherme en boucle (LAMP) est une technique à tube unique pour l'amplification de l'ADN1)

Avec Le WarmStart LAMP

Tendre vers un Open wetware est nécessaire mais de très haut niveau.


Il s'agit de réactifs et d'ADN (témoins et amorces). Ces sociétés ne vendent généralement pas aux particuliers et les prix baissent drastiquement lors de l'achat en gros.

Mix enzymatique

il s'agit d'un mélange prêt à l'emploi composé d'un brin isotherme amélioré Enzyme ADN polymérase Displaçant l'ADN avec des nucléotides et un tampon qui permettent à la réaction de se produire, tout ce que vous devez ajouter à ceci est un ensemble d'amorces et un échantillon.

pour simplifier est utilisé pour l'instant :

Dispo à travers leurs filiales / distributeurs.


Chaque jeu a 7 amorces :

  • 2 longues amorces internes
  • 2 amorces externes courtes
  • 2 amorces en boucle pour rendre la réaction plus rapide
  • 1 amorce de trempe pour éteindre la fluorescence lorsque la réaction est négative

Les amorces peuvent être commandées chez votre fournisseur local, mais sont moins chères en vrac. Le dessalement standard convient, sauf pour les sondes d'extinction qui doivent être

COX1 : Amorce de gène de plante

COX1 est commun à toutes les plantes

« COX fait partie d'un complexe d'enzymes qui convertit l'acide arachidonique en prostaglandine H2 (PGH2), le précurseur de tous les prostanoïdes. Le complexe consiste en une isoenzyme COX et une peroxydase. Actuellement on connaît trois isoenzymes COX : COX-1, COX-2 et COX-3. » fr:Cyclooxygénase
Cytochrome c oxidase subunit I Cytochrome c oxidase I (COX1) also known as mitochondrially encoded cytochrome c oxidase I (MT-CO1) is a protein that in humans is encoded by the MT-CO1 gene.[6] In other eukaryotes, the gene is called COX1, CO1, or COI.[7] Cytochrome c oxidase I is the main subunit of the cytochrome c oxidase complex. Mutations in MT-CO1 have been associated with Leber's hereditary optic neuropathy (LHON), acquired idiopathic sideroblastic anemia, Complex IV deficiency, colorectal cancer, sensorineural deafness, and recurrent myoglobinuria

Basé sur : Détection rapide de Phytophthora ramorum et P. kernoviae par extraction d'ADN en deux minutes

Suivi d'une amplification isotherme et d'une détection d'amplicon par un dispositif générique de flux latéral J. A. Tomlinson, M. J. Dickinson et N. Boonhamdoi : 10.1094/ PHYTO-100-2-0143

Amorce(s) Sequence 5’to3’ Modification
COX F3 tatgggagccgtttttgc
COX B3 aactgctaagrgcattcc 5’ FAM
COX FIP atggatttgrcctaaagtttcagggcaggatttcactattgggt
COX BIP tgcatttcttagggctttcggatccrgcgtaagcatctg
COX F-Loop atgtccgaccaaagattttacc
COX B-Loop gtatgccacgtcgcattcc
COX FIPQ YCAAATCCAT 3’ Black Hole Quencher®-1
Iowa Black® FQ
Amorces de gènes OGM

Promoteur CaMV-35S commun à la plupart des plantes OGM :

Basé sur : Real-time loop-mediated isothermal amplification for the CaMV-35S promoter as a screening method for genetically modified organisms ; Fukuta, S., Mizukami, Y., Ishida, A. et al Eur Food Res Technol(2004) 218 : 496.

Primer Sequence 5’to3’ Modification
35S_FIP aggcatcttcaacgatggccttaaaggaaggtggctcctaca
35S_BIP tgccgacagtggtcccaaagttgaagacgtggttggaacg 5’ FAM
35S_F3 tgcccagctatctgtcactt
35S_B3 tcccttacgtcagtggagat
35S_FLoop tcctttatcgcaatgatg
35S_BLoop agcatcgtggaaaaagaag
35S_BIP QACTGTCGGCA 3’ Black Hole Quencher®-1
Iowa Black® FQ

Dans chaque réaction de 10ul dans un tube PCR, nous avons à la fin :

  • 5ul LAMP mélange réactionnel
  • 3ul Mélange d'apprêt
  • 2ul échantillon

Guide pour 3x dilutions de mélange d'apprêt (à partir de 50/100 uM) pour différents nombres de réactions :

Amorce Amorce working
stock conc.
Amorce conc.
in10μl LAMP rxn
Vol. of primer
(1rxn) μL
Vol. of primer
(10rxn) μL
Vol. of primer
(50rxn) μL
Vol. of primer
(100 rxn)μL
Vol. of primer
(200 rxn)μL
Vol. of primer
(500 rxn)μL
FIP 50μM 1.6μM 0.4 4 20 40 80 200
BIP 50μM 1.6μM 0.4 4 20 40 80 200
F3 50μM 0.2μM 0.05 0.5 2.5 5 10 025
B3 50μM 0.2μM 0.05 0.5 2.5 5 10 25
FLP 50μM 0.8μM 0.2 2 10 20 40 100
BLP 50μM 0.8μM 0.2 2 10 20 40 100
Quencher 50μM 2.0μM 0.6 6 30 60 120 300
Free H²O
1.1 11 55 110 220 550
3 30 150 300 600 1500
Amorce Amorce working
stock conc.
Amorce conc.
in 10μl LAMP
Vol. of primer (1rxn) μL Vol. of primer (10rxn) μL Vol. of primer (50rxn) μL Vol. of primer
(100 rxn)μL
Vol. of primer
(200 rxn)μL
Vol. of primer
(500 rxn)μL
FIP 100μM 1.6μM 0.2 2 10 20 40 100
BIP 100μM 1.6μM 0.2 2 10 20 40 100
F3 100μM 0.2μM 0.025 0.25 1.25 2.5 5 12.5
B3 100μM 0.2μM 0.025 0.25 1.25 2.5 5 12.5
FLP 100μM 0.8μM 0.1 1 5 10 20 50
BLP 100μM 0.8μM 0.1 1 5 10 20 50
Quencher 100μM 2.0μM 0.3 3 15 30 60 150
Free H2O
2.05 20.5 102.5 205 410 1025
3 30 150 300 600 1500

Réalisation du mastermix

Nous voulons faire assez de mastermix pour X expériences

Chaque expérience est composée de 8 tubes, 4 pour le gène végétal et 4 pour le gène OGM.

Nous mélangeons 5μl*4*X LAMP mix avec 3μl*4*X Primer mix pour chaque ensemble de primaire.

Il est préférable d'en faire environ 10% de plus en cas d'erreur ou de déversement.

Fichiers sources


Vous pourriez laisser un commentaire si vous étiez connecté.
norae/biologicus/biohacking_note-protocole-analyses-gmo-1.txt · Dernière modification: 2020/01/22 18:15 par xavcc